Genomic Sequence Retrieval Kevin C. O'Kane, Ph.D. Professor Emeritus Computer Science Department University of Northern Iowa Cedar Falls, IA 50614 kc.okane@gmail.com https://threadsafebooks.com https://www.cs.uni.edu/~okane Nov 11, 2023 |
Copyright (c) 2004, 2005, 2006, 2015 2018, 2022, 2023 Kevin C. O'Kane, Ph.D.
Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.1 or any later version published by the Free Software Foundation; with the Invariant Sections being: Page 1, with the Front-Cover Texts being: Page 1, and with the Back-Cover Texts being: no Back-Cover Texts. |
-
Citation
O'Kane, K.C., The Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval, Online Journal of Bioinformatics, Volume 6 (2) 162-173, 2005.
-
Abstract
This software presents a method to identify weighted n-gram sequence fragments in large genomic databases whose indexing characteristics permits the construction of fast, indexed, sequence retrieval programs where query processing time is determined mainly by the size of the query and number of sequences retrieved rather than, as is the case in sequential scan based systems such as BLAST, FASTA, and Smith-Waterman, the size of the database. The weighting scheme is based on the inverse document frequency (IDF) method, a weighting formula that calculates the relative importance of indexing terms based on term distribution. In experiments (see citation above), the relative IDF weights of all segmented, overlapping, fixed n-grams of length eleven in the NCBI .nt. and other databases were calculated and the resulting n-grams ranked and used to create an inverted index into the sequence file. The system was evaluated on test cases constructed from randomly selected known sequences which were randomly fragmented and mutated and the results compared with BLAST and MegaBlast for accuracy and speed. Due to the speed of query processing, the system is also capable of database sequence clustering, examples of which are given below.
-
General Comments
This software is mainly aimed at Linux users.
This code has been developed under the Mint/Mate Linux distro.
-
Distributions
The full IDF distribution is to be found in::
Note: this distro is a simplified version of the original Source code distribution in Mumps Language Distro Click Here -
Example
The example shows a search for a randomly modified known sequence (exact match) in the gbpri* database. The IDF Score column gives the IDF metric of similarity. The Fasta results (W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448) are the result of running the same query sequence against the original gbpri input database.
Sequence Searcher Tue Sep 25 13:50:31 2018 Database files: /media/okane/ssd120/IDF-New/inputSequences/nt,old /media/okane/ssd120/work/words.merged,old Query: >gi | AC192344.3 | AC192344 | Pan troglodytes BAC clone CH251-157M8 fr 1531378284 GAATTCTCATACGCTGCTTGTGGGAATGTAAAATGGTGCCACCACTTTGGACAAACAGTCTGACAGTTTCTCAAATGGTTA AACATAGAGTTAACCTATGATTCAGGAATTCTACTCCAATGTATATACACACAGGAAATGGAAACATATGTCAACGCAAAA ACATATTCATGAGCAACATTATTTATAATAGCCAGAAGGGTGGAAACTACTTCATTTTTTTCAACCAAACACAGGATTAAA AAATTGTGATATATCCTTAGACTGGAATATGATTTAGCCATAAAAGAGAATGAAGTACTGGTATATGCTGCAATATGAATA AACCTTGAAAATATTATGCTAAGTGAAACAGACCAGTCACTAAAGATGTATGATTCCATCTTATATGAAACATCACGGATA GACAAATCTGCTTAGAGCTGACTGGGATGGGGAGATTGGGCAATAGCTAAAGAGTACAGGGTTTTGGTTCTTTTTTTGAGG TGACAAAAATGCTCAAAATTGAATGTAGTGATGGTTGCCCATATCTCTGAATATACAAAAAGCCATTGAACTGTGCACTTT ACGTGCATGAATTGCATGGTATGTGAACTACACCTTAATGAAGCTGGTATAAAATTTTTAATTTAGTGCCCGTTCTACAGA TTATAACATGCATAATCAACATATTACTGTTTAGTTTAAATGAATGCTTTTATCATTTCTTGAGCAACCTAATAACTTCAT AACCTTTTTTTGAGACAGGGTCTCACTCTGTCGCCCAGGCTGTATTGCAGTGGTGTGATCACAGCTCACTGCACTTTTGAC CTCCTGGGCTTAAGTGGTCCTCCCACCTCAGCCTCCTGAGTAGTTAGGACTACAAGTGTACATCACCATGCCTGGCTAATT TTTGTAGATACAGAGTCTCGCTATATTGCCCAGGCTGGGTCTCAAACTCCTGGGACTCAAGCAATCCATCTGCCTGCAGCC TCTCAAAGTGCTGGGATTACAAGTGTGAGCCATTGCACCCTGGTTCTTTATAACTCAACTCCATTTGTTCTCCTTCTACAT TTTTGTGTTACTGACATCAATATTTACTTCTTCATATATTTAAAATTTTATGAGGATATATTAAAGTTATCATTTCAAACC CTAAGGAAAGTATACATTTAGATTTAGTCACATATTCTTCCCAGTGCTTTTAATTTCTTCTTGAATTATTCTATCT IDF Results: IDF: 3795 >gi | AL133329.11 | AL133329 | Human DNA sequence from clone RP11-524P IDF: 3795 >gi | AC195289.3 | AC195289 | Pan troglodytes BAC clone CH251-716G17 f IDF: 3795 >gi | AC192344.3 | AC192344 | Pan troglodytes BAC clone CH251-157M8 fr IDF: 3795 >gi | AC169978.2 | AC169978 | Pan troglodytes chromosome X clone PTB-9 IDF: 659 >gi | LT160002.1 | LT160002 | Macaca fascicularis complete genome, chr IDF: 649 >gi | AP001711.1 | AP001711 AL163256 | Homo sapiens genomic DNA, chrom IDF: 632 >gi | LT160001.1 | LT160001 | Macaca fascicularis complete genome, chr IDF: 575 >gi | AC098675.2 | AC098675 AC034282 | Homo sapiens BAC clone RP11-370 IDF: 565 >gi | AC007314.3 | AC007314 | Homo sapiens BAC clone RP11-74G24 from 2 IDF: 562 >gi | BS000112.1 | BS000112 BA000046 | Pan troglodytes chromosome 22 c IDF: 504 >gi | AC068205.25 | AC068205 | Homo sapiens chromosome 11, clone RP11- IDF: 501 >gi | AC206440.2 | AC206440 | Pan troglodytes chromosome X clone CH251 IDF: 499 >gi | AL354861.11 | AL354861 | Human DNA sequence from clone RP11-180I IDF: 499 >gi | AC157755.2 | AC157755 | Pan troglodytes BAC clone CH251-416M24 f IDF: 498 >gi | AC087600.21 | AC087600 | Homo sapiens 12q BAC RP11-495C23 (Roswe IDF: 496 >gi | Z84484.1 | Z84484 | Human DNA sequence from clone RP1-50J22 on c IDF: 493 >gi | AC147285.3 | AC147285 | Pan troglodytes BAC clone RP43-81J3 from IDF: 492 >gi | AF099810.1 | AF099810 | Homo sapiens neurexin III-alpha gene, pa IDF: 490 >gi | AC093124.3 | AC093124 | Papio anubis clone RP41-216E17, complete IDF: 485 >gi | BA000025.2 | BA000025 AP000502-AP000521 | Homo sapiens genomic D IDF search time: 1 Fasta results: Fasta search time 98 The best scores are: opt bits E(969128) gi | AC192344.3 | AC192344 | Pan troglodytes B (154271) [f] 5840 355.8 7.7e-95 gi | AC169978.2 | AC169978 | Pan troglodytes c (215778) [f] 5840 355.4 1.1e-94 gi | AC195289.3 | AC195289 | Pan troglodytes B (189809) [f] 5840 355.1 1.3e-94 gi | AL133329.11 | AL133329 | Human DNA sequen (109508) [f] 5684 346.7 4.3e-92 gi | AC145336.19 | AC145336 | Pan troglodytes (155318) [f] 1294 95.0 2.5e-16 gi | AC145339.34 | AC145339 | Pan troglodytes (150845) [f] 1294 95.0 2.5e-16 gi | AC159032.2 | AC159032 | Pan troglodytes B (183880) [r] 1294 94.2 4.5e-16 gi | AC200436.3 | AC200436 | Pongo abelii BAC (202873) [f] 1182 88.6 2.2e-14 gi | AC198041.4 | AC198041 | Pongo abelii BAC (200198) [f] 1182 88.6 2.2e-14 gi | AC239452.3 | AC239452 | Chlorocebus aethi (174798) [f] 1105 83.2 9.2e-13